RetrogeneDB ID:
retro_ecab_958
Organism:
Horse ( Equus_caballus )
Location:
7:61630715-61631039 (-)
Status:
KNOWN_PSEUDOGENE
Aliases:
No gene alias available
Located in intron of:
None
Alignment summary

Identity:
99.07 %
Coverage:
94.74 %
Frameshifts:
0
Stop codons:
0


Parental gene:
Parental gene symbol:
No gene symbol available
Parental gene aliases:
No gene alias available
Parental gene description:
No gene description available

Genomic region (view in browser)





>retro_ecab_958
CTCGCCTGCATCTACTCAGCCCTCATCCTGCACGACGATGAGGTAACGGTCACGGAGGAT
AAGATCAATGCCCTCATTAAAGCAGCCGGTGTAAATGTCGAACCTTTCTGGCCAGGCTTG
TTTGCAAAGGCCCTGGCCAATGTCAGTATCGGGAGCCTCATCTGCAACGTGGGGGCTGGT
GGACCTCCGCCACCTGCTGGCGCTGCCCCAGCTGGAGGGCCTGCCCCCTCCACCGCTGCT
GCCCCAGCTGAGGAGAAGAAAGTGGAAGCAAAGAAAGAAGAATCTGAGGAGTCTGATGAT
GACATGGGCTTTGGTCTTTTTGAC

Library Expression (reads per million mapped reads)
SRP021940_articular_cartilage 421.97
SRP021940_cerebellum 113.86
SRP021940_embryo 131.02
SRP021940_placental_villous 126.63
SRP021940_synovial_membrane 222.87
SRP021940_testis 130.9

Parental protein coverage





Changes in the retrocopy sequence






Parental protein
LACIYSALILHDDKVTVTEDKINALIKAAGVNVEPFWPGLFAKALANVSIGSLICNVGAGGPPPPAGAAPAGGPAPSTAAAPAEEKKVEAKKEESEESDD
LACIYSALILHDD.VTVTEDKINALIKAAGVNVEPFWPGLFAKALANVSIGSLICNVGAGGPPPPAGAAPAGGPAPSTAAAPAEEKKVEAKKEESEESDD
Retrocopy
LACIYSALILHDDEVTVTEDKINALIKAAGVNVEPFWPGLFAKALANVSIGSLICNVGAGGPPPPAGAAPAGGPAPSTAAAPAEEKKVEAKKEESEESDD


Parental protein
DMGFGLFD
DMGFGLFD
Retrocopy
DMGFGLFD


Legend:
*
Stop codon
\
Forward frameshift by one nucleotide
/
Reverse frameshift by one nucleotide