RetrogeneDB ID:
retro_mputfur_1186
Organism:
Location:
GL897038.1:56853-57207 (+)
Status:
NOVEL
Ensembl ID:
None
Aliases:
No gene alias available
Located in intron of:
None
Alignment summary

Identity:
53.28 %
Coverage:
93.7 %
Frameshifts:
3
Stop codons:
4


Parental gene:
Parental gene symbol:
CBY1
Parental gene aliases:
No gene alias available
Parental gene description:
chibby homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:1307]

Genomic region (view in browser)





>retro_mputfur_1186
TCCAGTCAGAAAACTCCCCTCTAAAGTCAGCCTCCCTCTCCAATCTGCATTCTTTGGGTC
AGCCAACCCCAGAGATGGAGTCAGAATGTCACTGTGGAACCCCTACTATGAACCAGGAGG
GTGAAGCCTGACATCTGAAAGTGACCAGTGGATTACAGAGCCAGGGGCTGCTGAAGACAC
AAGTGGAAGGAAGCTTAGCACTTTTATGGTCAGAACTAGCATTTGAAGAGAAAAAGTAAT
CTCTTGTGGCTTAAAATATAGATTTTCATAAACATGCTATCTGGAACCACTGCTGAGTCC
CACTTAATGGAAAAGGAATAAGAGGAACTCTGGAGTATCACCTACAGGAGAAAA


Parental protein coverage





Changes in the retrocopy sequence






Parental protein
SPKKTP-PRKSASLSNLHNLDRSTREVELGLDYGTPTMNLAGQ-SLKFENGQWIAETGISGGVDRR-EAQRLRRRNQQLEEENNLLRLKVDILLDMLSET
S..KTP.P.KSASLSNLH.L...T.E.E.....GTPTMN..G..SL..E..QWI.E.G.......R.EA......N..L....NLL.LK..I...MLS.T
Retrocopy
SSQKTP/PLKSASLSNLHSLGQPTPEMESECHCGTPTMNQEGE/SLTSESDQWITEPGAAEDTSGR/EA*HFYGQN*HLKRKSNLLWLKI*IFINMLSGT


Parental protein
TAESHLMEKELEELKSVSRRRK
TAESHLMEKE.EEL.S...RRK
Retrocopy
TAESHLMEKE*EELWSITYRRK


Legend:
*
Stop codon
\
Forward frameshift by one nucleotide
/
Reverse frameshift by one nucleotide