RetrogeneDB ID:
retro_mputfur_1615
Organism:
Location:
GL897370.1:33052-33370 (+)
Status:
NOVEL
Ensembl ID:
None
Aliases:
No gene alias available
Located in intron of:
None
Alignment summary

Identity:
64.81 %
Coverage:
66.25 %
Frameshifts:
2
Stop codons:
2


Parental gene:
Parental gene symbol:
MAX
Parental gene aliases:
No gene alias available
Parental gene description:
MYC associated factor X [Source:HGNC Symbol;Acc:6913]

Genomic region (view in browser)





>retro_mputfur_1615
GACCTTGAGACGGAGAGTGACAAAGAGCAACGGAGGTTTCAATCTACGACTGACAAACCG
GCTCGTCATAATTTTCCGGAATGAAAACATAGGGAGCACATTAAGAAAGCTTTCCCAGTT
TGTGGTACTCAGTACCTGTCACTCCAAGGACAGAAGGCATCCCGGGCCCAAGTCCTAGAC
AAAGCCACAGAGGACATCCAGGAAATGTGAAGGAAAATCCACACACACCAGCAAGACACT
GATTACTTCAAGCAGCAGGATGTTCCTCTGGAGCAAGAAGTCCATGCACTGGAGACGGTG
AGGTGCAGTATCCAACTT


Parental protein coverage





Changes in the retrocopy sequence






Parental protein
DIEVESDEEQPRFQSAADKRAHHNALERKRRDHIK-DSFHSLRDSVP-SLQGEKASRAQILDKATEYIQYMRRKNHTHQQDIDDLKRQNALLEQQVRALE
D.E.ESD.EQ.RFQS..DK.A.HN..E.K.R.HIK..SF.SL..SVP.SLQG.KASRAQ.LDKATE.IQ.M.RK.HTHQQD.D..K.Q...LEQ.V.ALE
Retrocopy
DLETESDKEQRRFQSTTDKPARHNFPE*KHREHIK/ESFPSLWYSVP\SLQGQKASRAQVLDKATEDIQEM*RKIHTHQQDTDYFKQQDVPLEQEVHALE


Parental protein
KARSSAQL
..R.S.QL
Retrocopy
TVRCSIQL


Legend:
*
Stop codon
\
Forward frameshift by one nucleotide
/
Reverse frameshift by one nucleotide