RetrogeneDB ID:
retro_mputfur_192
Organism:
Location:
AEYP01110635.1:384-702 (+)
Status:
NOVEL
Ensembl ID:
None
Aliases:
No gene alias available
Located in intron of:
None
Alignment summary

Identity:
65.74 %
Coverage:
66.25 %
Frameshifts:
2
Stop codons:
2


Parental gene:
Parental gene symbol:
MAX
Parental gene aliases:
No gene alias available
Parental gene description:
MYC associated factor X [Source:HGNC Symbol;Acc:6913]

Genomic region (view in browser)





>retro_mputfur_192
GACCTTGAGACGGAGAGTGACAAAGAGCAACCGAGGTTTCAACCTACGACTGACAAACCG
GCTCGTCATAATTTCCCGGAATGAAAACATAGGGAGCACATTAAGAAAGCTTTCCCAGTT
TGTGGTACTCAGTACCTGTCACTCCAAGGACAGAAGGCATCCCAGGCCCAAGTCCTAGAG
AAAGCCACAGAGGACATCCAGGAAATGTGAAGGAAAAACCACACACACCAGCAAGACACT
GATGACTTCAAGCAGCAGGATGTTCCTCTGGAGCAAGAAGTCCATGCACTAGAGACGGTG
AGGTGCAGTGCTCAACTT


Parental protein coverage





Changes in the retrocopy sequence






Parental protein
DIEVESDEEQPRFQSAADKRAHHNALERKRRDHIK-DSFHSLRDSVP-SLQGEKASRAQILDKATEYIQYMRRKNHTHQQDIDDLKRQNALLEQQVRALE
D.E.ESD.EQPRFQ...DK.A.HN..E.K.R.HIK..SF.SL..SVP.SLQG.KAS.AQ.L.KATE.IQ.M.RKNHTHQQD.DD.K.Q...LEQ.V.ALE
Retrocopy
DLETESDKEQPRFQPTTDKPARHNFPE*KHREHIK/ESFPSLWYSVP\SLQGQKASQAQVLEKATEDIQEM*RKNHTHQQDTDDFKQQDVPLEQEVHALE


Parental protein
KARSSAQL
..R.SAQL
Retrocopy
TVRCSAQL


Legend:
*
Stop codon
\
Forward frameshift by one nucleotide
/
Reverse frameshift by one nucleotide