RetrogeneDB ID:
retro_mputfur_452
Organism:
Location:
GL896910.1:10900320-10900602 (-)
Status:
NOVEL
Ensembl ID:
None
Aliases:
No gene alias available
Located in intron of:
Alignment summary

Identity:
54.55 %
Coverage:
61.44 %
Frameshifts:
0
Stop codons:
3


Parental gene:
Parental gene symbol:
ORMDL2
Parental gene aliases:
No gene alias available
Parental gene description:
ORM1-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:16037]

Genomic region (view in browser)





>retro_mputfur_452
ATCTGGCTGGCCTGCATTGTCTTGGTAGGACTGCCTCATGTTCTACTCCGCATTCCTGTT
GTCTGGACCTGACCGACGCTGACTGACGCCATCCATAACTTGCCTATGGTGTCTTAATAT
ACAGTGAAAGGGACACCCTTTAAAACCCCTCACTAAGGGGTGACACACTGGAAACAGATG
GACTGTAGGCTCCAGTTTACGTCTTCCAACAAATTCCTCAGCCTTTCTCCCACTGTCCTC
TACCTCCTGGCCAGTTTCTGCACCTCATCTACACAGCCTCAT


Parental protein coverage





Changes in the retrocopy sequence






Parental protein
VGLLHVVLLSIP--FFSIPVVW---TLTNVIHNLAMYVFLHMVKGTPFETPDQGKARLLTHWEQMDYGLQFTSSRKFLSISPIILYLLASFYTKYDAAH
..L...VL...P.....IPVVW...TLT..IHNL.M.V....VKGTPF.TP..G.....THW.QMD..LQFTSS.KFLS.SP..LYLLASF.T.....H
Retrocopy
IWLACIVLVGLPHVLLRIPVVWT*PTLTDAIHNLPM-VS*YTVKGTPFKTPH*G----VTHWKQMDCRLQFTSSNKFLSLSPTVLYLLASFCTSSTQPH


Legend:
*
Stop codon
\
Forward frameshift by one nucleotide
/
Reverse frameshift by one nucleotide