RetrogeneDB ID:
retro_mputfur_483
Organism:
Location:
GL896913.1:4545887-4546088 (+)
Status:
NOVEL
Ensembl ID:
None
Aliases:
No gene alias available
Located in intron of:
None
Alignment summary

Identity:
52.94 %
Coverage:
51.13 %
Frameshifts:
0
Stop codons:
2


Parental gene:
Parental gene symbol:
HMGN1
Parental gene aliases:
No gene alias available
Parental gene description:
high mobility group nucleosome binding domain 1 [Source:HGNC Symbol;Acc:4984]

Genomic region (view in browser)





>retro_mputfur_483
GCTCCTGCCAATGTGGAAACTCAGCCAAAAAAGGTGGCAGGAAAGGAGAAATCTTCAGAC
TGAAAAGTGCCAACAAAGAGGGGAAAGGAGAGCTGAAGGAAACAGGCTGAAGGGGCCGGC
CGAGGACCGGCAGGCTTCCCCGCGGAAAATGGGGAAACCGAGAAGGAAAGTCCAGCCGCG
GATGACACCAAGTCTGATGAA


Parental protein coverage





Changes in the retrocopy sequence






Parental protein
APAKVEAKPKKAAAKDKSSDKKVQTKGKRGAKGKQAEVANQEAKDDLPAENGETKNESPASDEAGEKE
APA.VE..PKK.A.K.KSSD.KV.TK.......KQAE.A........PAENGET..ESPA.D.....E
Retrocopy
APANVETQPKKVAGKEKSSD*KVPTKRGKES*RKQAEGAGR-GPAGFPAENGETEKESPAADDTKSDE


Legend:
*
Stop codon
\
Forward frameshift by one nucleotide
/
Reverse frameshift by one nucleotide