RetrogeneDB ID:
retro_opri_283
Organism:
Location:
GeneScaffold_458:23277-23601 (-)
Status:
NOVEL
Ensembl ID:
None
Aliases:
No gene alias available
Located in intron of:
Alignment summary

Identity:
93.52 %
Coverage:
66.67 %
Frameshifts:
0
Stop codons:
0


Parental gene:
Parental gene symbol:
C18orf21
Parental gene aliases:
No gene alias available
Parental gene description:
chromosome 18 open reading frame 21 [Source:HGNC Symbol;Acc:28802]

Genomic region (view in browser)





>retro_opri_283
ATGAGACAGAAGCACTATCTCGAGGCTGCGGCGCGACAGCTGCGGGAGAGCTGTCCGGGC
CAGGCCCGCTACCTTCTATGGACCTACAGTTCCTCCCACGATGATAAGAACAGTTTTGAA
GAAACATGTCCATACTGTTTCCAGTTGTTAGTTCTGGATAATTCCCGAGTGCGCCTCAAA
CCCAAGCCCAAACTGACACCCAGAATACAGAAACTTCTTAATCGAGAAGCAAGAAATTCT
ACACTCAGTTTTAAAGAAGCAAAAATTTTGAAAAAGTACAGAGAATCCAAAAGTGTATTG
AACACCTACATCTGTACAGTCAAC


Parental protein coverage





Changes in the retrocopy sequence






Parental protein
MRQKHYLEAAARQLRESCPGQARYLLWTYSSSHDDKNSFEETCPYCFQLLVLDNSRVRLKPKPKLTPRIQKLLNREARNSTLSFKELKILKKYRESKSVL
MRQKHYLEAAARQLRESCPGQARYLLWTYSSSHDDKNSFEETCPYCFQLLVLDNSRVRLKPKPKLTPRIQKLLNREARNSTLSFKE.KILKKYRESKSVL
Retrocopy
MRQKHYLEAAARQLRESCPGQARYLLWTYSSSHDDKNSFEETCPYCFQLLVLDNSRVRLKPKPKLTPRIQKLLNREARNSTLSFKEAKILKKYRESKSVL


Parental protein
LVTCKTCN
.....T.N
Retrocopy
NTYICTVN


Legend:
*
Stop codon
\
Forward frameshift by one nucleotide
/
Reverse frameshift by one nucleotide